Gel Exp

By admin  

Gel Exp

eBay Logo  

Mary Kay Acne Treatment Gel~ Fresh~ Exp. Date 01/12 NEW


Mary Kay Acne Treatment Gel~ Fresh~ Exp. Date 01/12 NEW


$5.50


~ ORAJEL ~ Maximum Strength Gel, Lot of 2, Exp.2012


~ ORAJEL ~ Maximum Strength Gel, Lot of 2, Exp.2012


$0.99


Itch-X Fast Acting, Anti Itch Gel 1.25oz exp 8/2010 NEW


Itch-X Fast Acting, Anti Itch Gel 1.25oz exp 8/2010 NEW


$8.49


Clean & Clear Maximum Strength Persa-Gel 10 Exp 9/2011!


Clean & Clear Maximum Strength Persa-Gel 10 Exp 9/2011!


$6.99


ORTHO VAGINAL CONTRACEPTIVE CONDOM GEL QTY 10 EXP 2011


ORTHO VAGINAL CONTRACEPTIVE CONDOM GEL QTY 10 EXP 2011


$7.99


2 Mary Kay ACNE Treatment GEL NEW Exp. 01/12 Fresh! TWO


2 Mary Kay ACNE Treatment GEL NEW Exp. 01/12 Fresh! TWO


$9.99


REPHRESH VAGINAL GEL 8 APPLICATORS EXP 2011


REPHRESH VAGINAL GEL 8 APPLICATORS EXP 2011


$24.99


DR. SHEFFIELD'S ALCOHOL FREE TEETHING GEL - EXP 07/2012


DR. SHEFFIELD’S ALCOHOL FREE TEETHING GEL – EXP 07/2012


$3.99


Suzuki Boulevard M50 M-50 Saddlemen Gel Seat Exp Spec


Suzuki Boulevard M50 M-50 Saddlemen Gel Seat Exp Spec


$524.95


SADDLEMEN EXP GEL SEAT HONDA SHADOW 1100 SABRE


SADDLEMEN EXP GEL SEAT HONDA SHADOW 1100 SABRE


$524.95


Suzuki Intruder 1500 LC Saddlemen Gel Seat Exp Spec


Suzuki Intruder 1500 LC Saddlemen Gel Seat Exp Spec


$524.95


I-CAPS AREDS FORMULA 60 SOFT GELS EXP-8-2010


I-CAPS AREDS FORMULA 60 SOFT GELS EXP-8-2010


$0.99


750 Empty Gel Caps Gelatin Capsules Size 00   Exp. 2014


750 Empty Gel Caps Gelatin Capsules Size 00 Exp. 2014


$0.99


BioFreeze 1 Gallon Gel Pump Exp.2011 - Low Shipping!!


BioFreeze 1 Gallon Gel Pump Exp.2011 – Low Shipping!!


$103.95


BioFreeze 1 Gallon Gel Pump Exp.2011 - Low Shipping!!


BioFreeze 1 Gallon Gel Pump Exp.2011 – Low Shipping!!


$103.95


BioFreeze 1 Gallon Gel Pump Exp.2011 - Low Shipping!!


BioFreeze 1 Gallon Gel Pump Exp.2011 – Low Shipping!!


$103.95


MARY KAY ACNE TREATMENT GEL( ACNE MEDICATION ) EXP.2012


MARY KAY ACNE TREATMENT GEL( ACNE MEDICATION ) EXP.2012


$6.30


Mary Kay Acne Treatment Gel  New Package!! exp 11/11


Mary Kay Acne Treatment Gel New Package!! exp 11/11


$5.95


New & Fresh Mary Kay Indulge Soothing Eye Gel Exp. 2012


New & Fresh Mary Kay Indulge Soothing Eye Gel Exp. 2012


$9.99


NEW Obagi Clenziderm Serum Gel exp 2011


NEW Obagi Clenziderm Serum Gel exp 2011


$39.99


RITE AID VITAMIN E 1,000 I.U. 60 SOFT GELS EXP-10-2010


RITE AID VITAMIN E 1,000 I.U. 60 SOFT GELS EXP-10-2010


$0.99


11 Coupons $1/1 Lanacane Anti-Chafing Gel Exp. 09/13


11 Coupons $1/1 Lanacane Anti-Chafing Gel Exp. 09/13


$0.99


LOT OF 16 NEW CLEARASIL OIL-FREE GEL WASH 2011 EXP.DATE


LOT OF 16 NEW CLEARASIL OIL-FREE GEL WASH 2011 EXP.DATE


$29.99


Mary Kay Acne Treatment Gel~ Fresh~ Exp. Date 01/12 NEW


Mary Kay Acne Treatment Gel~ Fresh~ Exp. Date 01/12 NEW


$5.50


2 x Mederma Gel Scar Treatment - 20g  ~ exp 2012


2 x Mederma Gel Scar Treatment – 20g ~ exp 2012


$5.99



SEC.EXP.CRYS.CLR.GEL PEACH


SEC.EXP.CRYS.CLR.GEL PEACH


$3.90



Glutamine 90 soft gels by Sci-Fit [Exp DEC 2011]


Glutamine 90 soft gels by Sci-Fit [Exp DEC 2011]


$23.97


Its all about delivery! Virtually all sport nutrition products contain the same ingredients. The difference with Sci-Fit is our proprietary ph altered delivery system. By enhancing our supplements to an alkaline state it allows them to bypass through the digestive system and go directly into the blood stream. The end result is the modern athlete has to take far less product to get the same results…

Baba De Caracol / Gel de Caracol 4 oz (113.4g) Exp-9/2012


Baba De Caracol / Gel de Caracol 4 oz (113.4g) Exp-9/2012


$15.00


BABA O GEL DE CARACOL ALFA!!!!! 100 Natural comprobado y garantizado elimina esas penosas manchas en la piel cauzadas por el embarazo, sol, ance quemaduras, envejecimiento de la piel y otros mas!!!!!!!!…

SADDLEMEN EXP SPEC GEL SEAT KAWASAKI VULCAN 900 CLASSIC


SADDLEMEN EXP SPEC GEL SEAT KAWASAKI VULCAN 900 CLASSIC


$339.44


Brand new Saddlemen Explorer Special studded gel seat for:Kawasaki Vulcan 900 Classic 06-UPA good-looking seat thats comfortable for two-up touring with its contoured front and rear SaddleGel in both front and rear means extra comfort for both rider and passenger Saddlemen was developed to offer the cruiser rider style, comfort and craftsmanship Every seat is designed to maximize comfort while giv…

SADDLEMEN EXP GEL SEAT HONDA SHADOW 1100 SABRE


SADDLEMEN EXP GEL SEAT HONDA SHADOW 1100 SABRE


$489.20


Brand new studded Saddlemen Explorer Special gel seat with removable driver backrest for:Honda Shadow 1100 Sabre 00-UPSaddleGel in front and rear increases comfort for both rider and passenger Split-cushion design on front seat eliminates the hammock effect Saddlemen was developed to offer the cruiser rider style, comfort and craftsmanship Every seat is designed to maximize comfort while giving yo…

Suzuki Boulevard M50 M-50 Saddlemen Gel Seat Exp Spec


Suzuki Boulevard M50 M-50 Saddlemen Gel Seat Exp Spec


$549.07


 Saddlemen Explorer Special Seat with driver backrest 0810-02632005-2009 Suzuki Boulevard M50 LCThe perfect seat for comfortable two-up touringFully adjustable driver backrestBoth driver and passenger portions feature SaddleGelTailbone pressure is eliminated and lumbar support provided through the split-cushion designChrome studs follow a special stitch patternGeunuine leather cover provides …



Gel Exp

Production of Recombinant Proteins Gst L1, E6 and E7 Tag Hpv 16 to be Used in Luminex Assay for Antibody Detection Among Tunisian Female Population Wi

Production of recombinant proteins GST L1, E6 and E7 tag HPV 16 to be used in LUMINEX assay for antibody detection among Tunisian female population with cervical cancer and controls

Achour. M*a, Ben Younes. Ra, Kahla. Sa, Kochbati. Lb, Zeghal. Dc, Maalej. Mb, Zouari. Fc, Oueslati. Ra

a- Laboratory of Environmental Immuno-Microbiology and cancerogenesis (IMEC Unit) Faculty of Sciences Bizerta 7021 Zarzouna Tunisia.

b- Service of Radiotherapy Institute of Cancer Salah Azeiz Tunisia.

c- Service of Gynecology- obstetrics Center of Maternity and Neonatalogy Hospital La Rabta Tunisia.

*Corresponding author

Achour Mongia

E-mail: mahaachour2000@yahoo.fr

Tel: 216 72 591 845

Fax: 216 72 590 566

ABSTRACT:

Certain types of Human Papillomavirus (HPVs), mainly HPV types 16 and 18 have been recognised as major etiological factors for the development of cervical cancer. Antibodies against HPV antigens have been found to be associated with cervical cancer evolution. Different assays can be used for antibody detection but they have low levels of sensitivity and specificity. In the present work we are interested to prepare recombinant proteins to be used in LUMINEX technology in order to undergo serological study in Tunisian female population. So, HPV types 16 L1, E6 and E7 sequences fused to their 3’-end to a sequence encoding the terminal undecapeptide of the SV40 large T-antigen (tag) were isolated from plasmids and inserted into a pGEX vector for expression as GST fusion proteins in E.coli. Coding sequences for L1tag, E6tag and E7tag of HPV 16 respectively were mobilized by digestion with enzymes and ligated into digested plasmids downstream of the GST domain. An expression plasmid for GST tag was constructed by inserting a fragment coding for the tag epitope. Cells of E.coli BL 21 were transformed with the pGEX plasmids and grown in Luria Bertani medium containing the ampicillin. Recombinant proteins expression was induced by adding 0.25 mM isopropyl-?-D-thio-galactoside (IPTG) to the medium. The bacteria were harvested after induction and pelleted bacteria were resuspended in phosphate buffered saline (PBS) and lysed using a high- pressure homogenizer. Lysates were then cleared by centrifugation.

Proteins were verified by migration in sodium dodecyl sulphate (SDS) gel electrophoresis. Data showed that they were stable for detection and these lysates have been conserved at -20°C to be used in Luminex for detection of antibodies in female Tunisian population. This assay showed that the sero- positivity toward the different antigens differs upon the group studied and differences between cases and controls were significant (P

Key-words: GST tag – E coli – HPV 16 – L1 – E6 – E7 – LUMINEX

INTRODUCTION:

On a global level, human papillomavirus (HPV) is estimated to cause almost half a million cases and more than 270,000 deaths from cervical cancer, corresponding to more than 2.5 million years of life lost (YLL) annually (Sue et al., 2007).

HPV type 16 (and to a lesser degree HPV type 18) is linked with more rare cancers, namely cancer of the vulva, vagina, penis, anus, oropharynx and larynx. Effective prophylactic vaccines have been developed (Dillner et al., 2007). Molecular epidemiological studies have demonstrated that specific subtypes of HPV are associated with cervical cancer (Castle and Giuliano, 2003; Dillner and Brown, 2004).

The HPV group of viruses today consists of more than 100 completely characterized types. Partial sequences of additional isolates indicate that at least another 100 HPVs exist. Of these, 15 genital HPVs are established as oncogenic in humans. HPV type 16 is by far the most important virus, accounting for more than 50% of all cervical cancers. HPV16 is even more dominating as an etiology of the noncervical HPV-associated cancers (Dillner, 2005). HPV serology is complex for several reasons. Different types of HPV can infect the epithelia of skin or mucosa and induce proliferative diseases. HPV antibodies are type specific. Those targeting the major viral capsid protein L1 are markers of infection, and those targeting the viral oncoproteins E6 and E7 are markers for HPV-associated cancer (Waterboer et al., 2005). Conventional serologic methods such as ELISA allow the analysis of sera for antibodies to only 1 antigen per well. Previous studies have determined antibodies against early antigens as E6 protein by ELISA methods that use small, linear epitopes of the proteins but sometimes they show low sensitivities and specificities. To improve the immunologic method, other approaches have been advanced like radioimmunoprecipitation assays (RIPAs) with whole native proteins and sandwich ELISAs with full-length (Meschede et al., 1998). Today, HPV serology is performed mostly in a limited number of laboratories, but it is likely to become widely used in clinical laboratories in the post-HPV vaccination sera. Previous studies showed that the LUMINEX method constitutes an attractive method for HPV serology in high-throughput laboratories (Waterboer et al., 2006).

In the present report, viral antigens were expressed with pGEX vectors in Escherichia coli as double fusion proteins with N-terminal GST and a C-terminal peptide (tag) consisting of the 11 C-terminal amino acids from the large T antigen of simian virus 40. The protein concentrations of the cleared lysates have been determined using the Bradford-reagent and the characterization of the full-length recombinant proteins was verified by coomassie-stained SDS-PAGE. Furthermore, the titration of antigen lysates was done using mouse anti-tag antibodies. These antigens were then used in LUMINEX assay for antibody detection in Tunisian female population.

MATERIALS AND METHODS:

HPV 16 L1

A modified pGEX vector was constructed for expression of GST fusion protein with an additional C-terminal fusion tag in E.coli. HPV 16 L1 coding sequence lacking the 10 N-terminal residues was amplified by polymerase chain reaction PCR with SmaI/SalI ends and inserted into pGEX4T3tag opened by EcoRI digestion.

PCR primers:

HPV 16 L1 forward 5’GCAGTCCCCGGGGTCTACTTGCCTCCTGTCC

HPV 16 L1 reverse 5’GCATGAGTCGACCAGCTTACGTTTTTTGCGTTTAGC

E.coli BL21 cells transformed with the pGEX plasmids were grown at room temperature in Luria Bertani medium containing 1mM ampicillin; At an OD600 of 0.3 recombinant protein expression was induced by adding 0.25 mM isopropyl-?-D-thio-galactoside (IPTG) to the medium. The bacteria were harvested by centrifugation 15 h after induction. Pelleted bacteria were resuspended in 40 mM Tris pH 8, 200 mM NaCl, 1 mM EDTA (ethylenediaminetetraaceticacid) and 2 mM DTT (dithiothreitol) supplemented with complete protease inhibitor cocktail and lysed using a high pressure homogenizer. ATP (adenosine triphosphate) and MgCl2 were added to final concentration of 2 mM and 5 mM respectively (Sehr et al., 2001).

HPV 16 E6 and E7

HPV type 16 E6 and 16 E7 coding sequence fused at its 3’-end in frame to a sequence encoding the terminal undecapeptide of the SV40 large T-antigen (tag) is isolated from bluescript plasmid and inserted into a pGEX vector for expression as GST fusion protein in E.coli. These coding sequences for E6tag and E7tag were mobilized by digestion and ligated into digested plasmid downstream of the GST domain.

Then, E.coli BL 21 cells transformed with the pGEX plasmids were grown and induction protein expression was induced as previously described for L1. The bacteria were harvested 6h after induction by centrifugation. Pelleted bacteria were resuspended in PBS containing 2 mM DTT, 1% Triton X-100, and complete protease inhibitor cocktail and lysed with the high-pressure homogenizer. Lysates were then cleared by centrifugation and stored in aliquots at -20°C (Sehr et al., 2002).

Titration of proteins

– To determine the concentrations of different lysates we used the Bradford-reagent method

as previously described. Optic density has been measured at 595 nm (Bradford, 1976).

– The separation of recombinant proteins has been done by migration on 12% polyacrylamid gel electrophoresis and bands were revealed by coomassie staining.

– Titration of antigens: Lysates corresponding to GST L1tag and GST E6tag and GST E7tag were diluted in 1/3 steps, we start with the final concentration of 2 µg/µl and the detection of antigens was allowed by mouse anti-tag antibodies diluted to 1/4000, the optic density was then determined at 450 nm.

LUMINEX

Hardware and software Measurements were performed on a Luminex 100 Total System comprising the Luminex 100 analyzer, Luminex XYP plate handler, Luminex SD sheath fluid delivery system, a Pentium 4 personal computer (Dell) running Windows 2000 (Microsoft Corp.), and Luminex IS 2.2 SP1software (Waterboer et al., 2005).

Multiplex serology has been described in detail by Waterboer et al., 2005. Briefly, the method employs beads derivatized with glutathione, thereby permitting bead-mediated in situ affinity purification of viral antigens bacterially expressed as GST fusion proteins.

Spectrally distinct bead sets carrying different viral antigens were individually washed and subsequently mixed. Each sample of unfiltered diluted serum in preincubation buffer and mixed beads was combined and incubated. Bound antibodies were detected with biotinylated anti-human secondary antibody (goat anti-human IgG) and fluorescent detection conjugate (streptavidin-Rphycoerythrin). With the Luminex analyzer, reporter fluorescence of the beads was determined and expressed as median fluorescence intensity (MFI).

Viral antigens were expressed with pGEX vectors in Escherichia coli as double fusion proteins with N-terminal GST and a C-terminal peptide (tag) consisting of the 11 C-terminal amino acids from the large T antigen of simian virus 40. The expression constructs for E6, E7, and L1 of HPV types 16 as GST fusion proteins have been described (Sehr et al., 2001, 2002).

Bacterial lysate was diluted to 1 g/L in casein buffer (1 g/L casein in PBS, pH 7.4). For each antigen, GC beads were loaded with GST fusion proteins directly in the lysate and incubated for 1 h at room temperature in the dark on a shaker. The beads were then washed 3 times with 1 mL of casein buffer. Human sera from a case-control study divided into 70 controls and 71 cervical cancer cases. Ethics committee approval and informed consent of study participants for HPV serology were obtained. Sera were preincubated at a 1:50 dilution on a shaker for 1 h at room temperature in a serum preincubation buffer based on casein buffer and additionally containing 2 g/L lysate from bacteria expressing GST alone to block antibodies directed against residual bacterial proteins and GST.

Multiplex assay:

Bead sets carrying different antigens were mixed and 50 µL each of preincubated diluted serum and mixed beads were combined in 96-well plates with filter bottoms and incubated on a shaker for 1 h at room temperature in the dark. The beads were washed 3 times in 100 µL of casein buffer on a vacuum manifold. Biotinylated secondary antibody [goat anti-human IgG diluted 1:1000 in casein buffer was added and incubated as before. After washing, detection conjugate (streptavidin-R-phycoerythrin) diluted 1:1000 in casein buffer was incubated with the beads for 30 min. The beads were washed again, and the wells were filled with casein buffer. Reporter fluorescence of the beads was determined with the LUMINEX analyzer and expressed as median fluorescence intensity (MFI). To calculate antigen-specific reactivity, the MFI of GST tag was subtracted from the antigen MFI. This multiplex HPV serology method used in situ affinity–purified viral antigens developed yet for a conventional GST capture ELISA as previously described (Sehr et al., 2001).

RESULTS:

Using the Bradford method, we have determined concentrations of the three protein lysates by the measurement of optic density at 595 nm. GST L1tag, GST E6tag and GST E7tag have the following concentrations: 16, 19 and 23.5 µg/µl respectively.

The lysates were from bacteria over expressing GST L1tag (lane 3), GST E6tag (lane 5), GST E7tag (lane 4), GST tag (lane 2). Proteins were separated by gel electrophoresis and stained with coomassie.

M. molecular weight marker with molecular mass in kDa indicated in the left (lane 1).

As shown in this figure, the different bands obtained corresponding to the different recombinant proteins showing different apparent molecular weights. GST L1tag showed by migration in gel electrophoresis an 82 kDa molecular weight, and approximately 40-45 kDa for HPV 16 E7 and E6 GST fusion proteins respectively. However, the GSTtag showed a band of about 31 kDa.

For the determination of limit of detection of these proteins, different dilutions have been effectuated. As shown in figure 2, and using lower concentrations, the best detection was obtained for GST alone, followed by E7 then E6 and L1 antigens.

Data showed elevated percentages of sero-positivities in cervical cancer cases compared to controls toward the three antigens L1, E6 and E7 analysed using the LUMINEX assay: 21%, 44% and 61% respectively and differences in results between cases and controls were significant (P

In addition, the technology LUMINEX allowed us to determine the intensity of the antibody response by analysing the MFI values determined for the different groups of patients toward the three antigens tested. Data showed that among cervical cancer cases, the distribution of the MFI values was different and it depends on the antigen type and the higher intensity of fluorescence was noted for the early antigens E6 and E7 compared to the late antigen L1. In fact, these values did not exceed 5609 units for L1 while for E6 and E7, higher MFI values reaching 13317 and 13235 were noted for E6 and E7 antigens respectively.

DISCUSSION:

In the present work, we have produced three recombinant proteins for HPV 16 as GST L1tag, GST E6tag and GST E7tag in E.coli. After production, we have verified the size of these proteins by separation on gel electrophoresis and results obtained were in agreement with the literature (Sehr et al., 2001, 2002).

Previous studies showed that different systems can be used for the production of viral expression for the HPV 16 (Biemelt et al., 2003). In fact, Virus-like particles (VLP) have been expressed in various systems: mammalian cells, yeast, Baculovirus, Transgenic plants, Semliki Forest Virus, Salmonella as well as E.coli (Sasagawa et al., 1995; Hagensee et al., 1993; Lyengar et al., 1996; Kirnbauer et al., 1993; Neeper et al., 1996). Among these various systems which can be used, the literature has reported that yeast could produce large quantities of recombinant protein in its native conformation, and the potential of contamination by toxins or infectious viruses is minimal compared to bacterial or mammalian expression systems. Moreover, yeast is a suitable host for the production of heterologous eukaryotic proteins since it allows posttranslational processing of polypeptides, such as folding and phosphorylation. In fact, previous studies have expressed HPV 16 E7 proteins in Schizosaccharomyces pombe and they have used a protocol of purification (Braspenning et al., 1997).

Yeast such as Sz. pombe is a system that has several advantages (Yuko et al., 1999). In fact, it can be handled conveniently, low-cost synthetic medium is used, and several milligrams of recombinant proteins can be produced. Braspenning et al., 1997 have developed purification protocol to obtain human papillomavirus HPV type 16 E7 proteins expressed in the yeast Sz. pombe by chromatography. In previous works, authors have expressed recombinant E6tag and E7tag proteins for HPV 16 and HPV 18 in Sz. Pombe (Meschede et al., 1998). The purified recombinant proteins were separated in silver-stained sodium dodecyl sulphate polyacrylamide gels. Production of antigens in plants is known to be safe and potentially very cost-effective alternative to traditional expression systems. HPV 16 L1 major capsid proteinhave been expressed in Nicotiana tabacum cv. Xanthi plants in order to produce prophylactic vaccines. This system is not easy to practise frequently (Varsani et al., 2003).

Compared to others, the E/coli system used in our work, has the advantage of the ease of antigen production and purification and provides large amounts of proteins which can be used for a wide range of studies including antigen and vaccine production; molecular immunology and structural biochemical and cell biology studies. Although a wide variety of E.coli host strains can be used for cloning and expression with the pGEX vectors, some strains as E.coli strain BL 21 maximize expression of full-length fusion proteins. This strain is defective in Omp T and Lon protease production and is the only strain able to express the fusion protein in a soluble intact form. In addition, the Glutathione-S-Transferase (GST) Gene Fusion System provides an integrated system for the expression, purification and detection of glutathione-S-transferase fusion proteins using E.coli (Saluta and Bell, 1998).

More recently, researchers have reported the transient expression mediated by a potato virus X derived vector of the E7 protein targeted to the secretory system of Nicotiana benthamiana (Franconi et al., 2006).

In addition, production of recombinant proteins L1, E6 as well as E7 and their stability have been verified. Higher detection was obtained for GST and at the same concentration, the detection of E6 and E7 is higher than L1. The differences noted concerning the production as well as the capacity of detection with the mouse anti-tag antibodies of the different recombinant proteins GST L1tag, GST E6tag and GST E7tag may be explained by the fact that L1 protein has relatively high molecular weight that is why it needs more steps of purification for the liberation of the bacterial proteins that can grow with the recombinant proteins (Waterboer et al., 2005).

These protein antigens prepared with the concentrations of 16, 19 and 23.5 µg/µl for L1, E6 and E7 respectively have been used in LUMINEX assay for antibody detection in Tunisian female human sera. This multiplex system enables antibody analyses of large numbers of sera against the different antigens in parallel and has the potential to replace ELISA technology.

Consequently, this method allows the simultaneous analysis of large numbers of serum samples for antibodies against multiple viral antigens would be useful for sero-epidemiologic studies on prevalence and disease association of human papillomaviruses (HPVs).

The literature has reported that HPV antibodies are type specific. Those targeting the major viral capsid protein L1 are markers of infection and those targeting the viral oncoproteins E6 and E7 are markers for HPV-associated cancer (Dillner, 2005; Waterboer et al., 2005). Data reported in the present work showed that the intensity of the antibody response was important for the early antigens E6 and E7 compared to L1 antigen and this may be explained by differences in characteristics of these proteins. The antibody response to HPV is, in general, type specific, and HPV serology is an important technology for determining the spread of type-specific HPV infections in populations and monitoring of the effect of HPV vaccines in inducing protective antibodies. The literature have showed that the antibodies against the major HPV capsid protein, L1, are induced after infection and usually stay detectable for many years after clearance of the infection, since they belong to the class of antibodies that mark past exposure to an infection. The concentrations of these antibodies correlate well with protection, and it is for L1 antibodies that there is an urgent need for efficient, standardized HPV serologic methods for use in vaccination implementation/evaluation efforts and for epidemiologic monitoring of the type-specific spread of HPV infections (Dillner, 2005).

In the present work uses the Luminex improved the sensitivity of antibody response and can replace conventional serologic methods such as ELISA which allow the analysis of sera for antibodies to only 1 antigen per well. However, this method for multiplex HPV serologic analysis combines the fluorescent bead array with a generic method allowing in situ affinity purification of any glutathione S-transferase (GST) fusion protein developed for conventional ELISA.

High-density planar arrays allow the analysis of very large numbers of targets but are limited in the number of samples that can be analyzed in a reasonable time frame at acceptable costs.

As a conclusion, production of recombinant proteins in E.coli enabled us to obtain recombinant proteins of HPV types as well as many other proteins relatively easy and in large quantities. Increased sensitivity and low imprecision of the Luminex-based method and the possibility for easy combination of different antibody assays lead to renewed interest in the use of these antibodies in predictive oncology.

Furthermore, using the LUMINEX technology and in countries lacking a cervical screening programme as our country we are able to investigate the feasibility of the serology analysis for sero-epidemiologic study or for vaccination purpose in Tunisian female population by parallel testing for antibodies against three antigens (E6, E7, and L1 proteins of HPV 16 type).

Acknowledgements:

We would like to thank Dr. Pawlita M and Dr. Sehr P and Dr Waterboer.T from the DKFZ Heidelberg Germany) for providing me all the products and materials necessary to the LUMINEX application.

References:

Biemelt S, Sonnewald U, Galmbacher P, Willmitzer L, Muller M (2003). Production of Human Papillomavirus Type 16 Virus-Like Particles in Transgenic Plants. J. Virol. 77: 9211-9220.

Bradford MM (1976). A rapid and sensitive method for the quantitation of quantities of protein utilising the principle of protein-dye binding. Ana. Biochem. 72: 248-254.

Braspenning J, Manetti R, Zumbach K, Meschede W, Gissman L, Tommasino M (1997). A General Purification Protocol for E7 Proteins from “High-and Low-Risk” Human Papillomavirus Types Expressed in the Yeast Schizosaccharomyces pombe. Prot. Expr. Purif. 10: 192-201.

Castle PE, Giuliano AR (2003). Genital tract infections, cervical inflammation, and antioxidant nutrients – assessing their roles as human papillomavirus cofactors. J. Natl. Cancer. Inst. Monogr. 31: 29-34.

Dillner J, Brown DR (2004). Can genital-tract human Papillomavirus infection and cervical cancer be prevented with a vaccine? Expert. Rev. Mol. Med. 9: 1–21.

Dillner J (2005). Toward “Serolomics”: Papillomavirus Serology Is Taking a Technologic Lead in High- Throughput Multiplexed Antibody Analysis. Clinical. Chemistry. 51: 1768-1769.

Dillner J, Arbyn M, Dillner L (2007). Translational Mini-Review Series on Vaccines: Monitoring of human papillomavirus vaccination. Clin. Exp. Immunol. 148: 199-207.

Franconi R, Massa S, Illiano E, Mullar A, Cirilli A, Accardi L, Di Bonito P, Giorgi C, Venuti A (2006). Exploiting the plant secretory pathway to improve the anticancer activity of a plant derived HPV 16 E7 vaccine. Int. J. Immunopathol. Pharmacol.19: 187-197.

Hagensee M.E, Yaegashi N, Galloway Dan (1993). Self-assembly of human papillomavirus type 1 capsids by expression of the L1 protein alone or by co-expression of the L1 and L2 capsid proteins. J. Virol. 67: 315-322.

Iyengar S, Shah KV, Kotloff KL, Ghim SJ, Viscidi RP (1996). Self-assembly of in vitro-translated human papillomavirus type 16 L1 capsid protein into virus-like particles and antigenic reactivity of the protein. Clin. Diagn. Lab. Immunol. 3: 733-739.

Kirnbauer R, Taub J, Greenstone H, Roden R, Durst M et al, Lowy DR, Schiller JT (1993). Efficient self- assembly of human papillomavirus type 16 L1 and L1-L2 into virus-like particles. J. Virol, 67: 6929-6936.

Meschede W, Zumbach K, Braspenning J, Scheffner M, Bribiesca L-B, Luande J, Gissman L , Pawlita M (1998). Antibodies against early proteins of human papillomaviruses as diagnostic markers for invasive cervical cancer. J. Clin. Microbiol. 36:475–80.

Neeper M. P, Hofmann KJ, Jansen KU (1996). Expression of the major capsid protein of human papillomavirus type 11 in Saccharomyces cerevisiae. Gene.18: 1-6.

Saluta M, Bell PA (1998). Troubleshooting GST fusion protein expression in E.coli. Life Science News, Amersham. Biosciences: 1-3.

Sasagawa T, Pushko P, Steers G, Gschmeissner SE, Hajibagheri MA, Finch J, Crawford L, Tommasino M (1995). Synthesis and assembly of virus-like particles of human papillomaviruses type 6 and type 16 in fission yeast Schizosaccharomyces pombe. Virology. 206:126-135.

Sehr P, Zumbach K, Pawlita M (2001). A generic capture ELISA for recombinant proteins fused to glutathione S-transferase: Validation for HPV serology. J. Immunol. Methods. 253: 153-162.

Sehr P, Muller M, Hopfl R, Widschwendter A, Pawlita M (2002). HPV antibody detection by ELISA with capsid protein L1 fused to glutathione S-transferase. J. Virol. Methods. 106: 61-70.

Sue JG, Jane JK, Katie K, Jeremy DG, Joshua S, Meredith KH O’Shea, F. Xavier B, Silvia de Sanjos´e c, Eduardo LF (2007). Cost-effectiveness of HPV 16, 18 vaccination in Brazil. Vaccine. 25: 6257-6270.

Varsani A, Williamson A-L, Rose RC, Jaffer M, Ribicki EP (2003). Expression of Human papillomavirus type 16 major capsid protein in transgenic Nicotiana tabacum cv. Xanthi. Arch. Virol. 148: 1771-1786.

Waterboer T, Sehr P, Pawlita M (2006). Suppression of non-specific binding in serological Luminex assays. J. Immunol. Methods. 309: 200– 204.

Waterboer T, Sehr P, Michael KM, Franceschi S, Nieland JD, Joos TO, Templin MF, Pawlita M (2005). Multiplex human papillomavirus serology based on in situ–purified glutathione S-transferase fusion proteins. Clin. Chem. 51: 1845–53.

Yuko GH, Hiromichi K (1999). Expression system for foreign genes using the fission yeast Schizosaccharomyces pombe. Biotechnol. Appl. Biochem. 30: 235-244.

About the Author

Corresponding author:

Achour Mongia

YTLE#99: The Number e in Excel

Share and Enjoy:
  • Print
  • Digg
  • Sphinn
  • del.icio.us
  • Facebook
  • Mixx
  • Google Bookmarks
  • Blogplay

Post a Comment

Your email is never shared. Required fields are marked *

*
*